Skip to main content

Table 1 SNP and qRT-PCR primers of IDO1 and IDO2

From: Single-nucleotide polymorphisms and activities of indoleamine 2,3-dioxygenase isoforms, IDO1 and IDO2, in tuberculosis patients

Primer Primer sequences (5′–3′) PCR purpose
IDO1-Exon2&3 GAAGGCAAGGCATACTATCAG SNPs
GGAAAGTTAAATGTAAATTAGATG
IDO1-Exon4 CAGGAGCAAGACTCCATCTC SNPs
GTAGTGGTAGACACAGCAGTC
IDO1-Exon6 GATAGTAAGGCCTGCCACAC SNPs
GTTTAGGCTCCGAAGTGATTG
IDO1-Exon7 CTGGACAACTGAGCGAGACTC SNPs
CTATTCTACACCTGGAACATTTG
IDO2-R248W GAACATTCTATCCCCCGTTGC SNPs
TTACCTGAGAGTGGATCCCTAGCA
IDO2-Y359X TCTTGTGCTCCCTCCAAAACA SNPs
TGGTTTGGCTTCCCATGCTT
Human IDO1 GATGTCCGTAAGGTCTTGCCA qRT-PCR
TGCAGTCTCCATCACGAAATG
Human IDO2 CTGATCACTGCTTAACGGCA qRT-PCR
TGCCACCAACTCAACACATT
Human β-actin TGGCACCCAGCACAATGAA qRT-PCR
CTAAGTCATAGTCCGCCTAGAAGC
Mouse IDO1 ATCGC AGCTT CTCCTGCAAT qRT-PCR
TGTAT CGATG GTCAGACCTC
Mouse IDO2 A TA CTG GCC TCT GGT CCT qRT-PCR
GGTGGCAGC GGA GAT AAT
Mouse β-actin AGCCATGTACGTAG CCATCC qRT-PCR
CTCTCAGCTGTGGTGGTGAA