Skip to main content

Table 1 The primers using for PCR amplification

From: Multiomics landscape of the autosomal dominant osteopetrosis type II disease-specific induced pluripotent stem cells

NO. Target Sequence TM (°C)
1 ENST00000162749 F: CTGTACGCCGTGGTGGAGAAC
R: TCGTGGTCGCTCAGCCCTA
60
2 ENST00000398795 F: ATCAGAGCAGAGAAAGCGATGG
R: GATGGGATGTCGGTGGCATTA
60
3 ENST00000329608 F: TAGGCAACGAGCGACAGG
R: GTAGGGCAGGGTCTCTTAGC
60
4 ENST00000316804 F: CTCCGACTCCAGATATGAACAG
R: GAGAAGCAGGATGAGGAAGAG
60
5 ENST00000285379 F: GCCTCCTTCCTGAATCCTTGG
R: CTGATGGGTTCCTTGAGCACAA
60
6 ENST00000382745 F: AGAAGGTCGGCGTCATTGTG
R: GGCAGGCTGGGTGTCATC
60
7 ENST00000193322 F: GGTGGTAAGTGCCTGTAGTCCTA
R: GCAGTGGTACAATCTTGGCTCAT
60
8 hsa-miR-29a-3p F: CGGCGGTAGCACCATCTG
R: GTCGTATCCAGTGCAGGGTCCGAGGTATTC
GCACTGGATACGACTAACCG
60
9 hsa-miR-3165 F: TCGCAGGTGGATGCAATGT
R: GTCGTATCCAGTGCAGGGTCCGAGGTATTC
GCACTGGATACGACTGAGGT
60
10 hsa-miR-410-3p F: GCGGCGGAATATAACACAGAT
R: GTCGTATCCAGTGCAGGGTCCGAGGTATTC
GCACTGGATACGACACAGGC
60
11 hsa-miR-520 h F: GGCGACAAAGTGCTTCCCT
R: GTCGTATCCAGTGCAGGGTCCGAGGTATTC
GCACTGGATACGACACTCTA
60
12 hsa-miR-1226-3p F: GCGTCACCAGCCCTGTGT
R: GTCGTATCCAGTGCAGGGTCCGAGGTATTC
GCACTGGATACGACCTAGGG
60
13 hsa-miR-373-5p F: TCAAAATGGGGGCGCTT
R: GTCGTATCCAGTGCAGGGTCCGAGGTATTC
GCACTGGATACGACGGAAAG
60
14 hsa-miR-1343-3p F: TCTCCTGGGGCCCGC
R: GTCGTATCCAGTGCAGGGTCCGAGGTATTC
GCACTGGATACGACGCGAGA
60
15 GAPDH F: TGCACCACCAACTGCTTAGC
R: GGCATGGACTGTGGTCATGAG
60
16 U6 F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
60
  1. Note: F, forward primer; R, reverse primer; TM, annealing temperature