Skip to main content

Table 2 The basic information and primer sequence of SNPs

From: Association of pigmentation related-genes polymorphisms and geographic environmental variables in the Chinese population

SNP-ID Chromosome Position Alleles Genes 1st-PCRP 2nd-PCRP UEP_SEQ
rs11568737 5 33,944,743 T > C SLC45A2 ACGTTGGATGGTGATCACCACGACGACAAC ACGTTGGATGATGGTGCAGCTGGCTCAGAT gGGGCTTTCTGGTCAAC
rs28777 5 33,958,854 C > A SLC45A2 ACGTTGGATGAAAAGGCTTCCACTCAGTTG ACGTTGGATGCAAGAGTCGCATAGGACAGG cctcCGTCCCATCCACTCAGAG
rs183671 5 33,964,105 T > G SLC45A2 ACGTTGGATGTCCTCATGCATAGACACTCC ACGTTGGATGATATCCAGGTTGCCTCTGCT ggcaTCTGCTGTCTTCAGGG
rs1042602 11 89,178,528 C > A TYR ACGTTGGATGTGACCTCTTTGTCTGGATGC ACGTTGGATGGGTGCTTCATGGGCAAAATC TCAATGTCTCTCCAGATTTCA
rs1393350 11 89,277,878 G > A TYR ACGTTGGATGGCATATCCACCAACTCCTAC ACGTTGGATGGGAAGGTGAATGATAACACG TTTGTAAAAGACCACACAGATTT
rs1126809 11 89,284,793 G > A TYR ACGTTGGATGAATGGGTGCATTGGCTTCTG ACGTTGGATGCCTCTGCAGTATTTTTGAGC catcTTGAGCAGTGGCTCC
  1. SNP single nucleotide polymorphism, Chr chromosome, PCRP polymerase chain reaction primer, UEP_SEQ unique base extension primer sequence