Skip to main content

Table 1 Primer Sequences for q-PCR

From: Identification and characterization of miRNAs associated with sterile flower buds in the tea plant based on small RNA sequencing

miRNA name Primer Sequence (5′ to 3′)
miR172e-3p F:ACACTCCAGCTGGGGGAATCTTGATGAT
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGATGCAGC
miR172a F:ACACTCCAGCTGGGAGAATCTTGATGAT
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGATGCAGC
miR164a F:ACACTCCAGCTGGGTGGAGAAGCAGGGC
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGCACGT
miR164c-5p F:ACACTCCAGCTGGGTGGAGAAGCAGGGC
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCACGT
miR160a-5p F:ACACTCCAGCTGGGTGCCTGGCTCCCTG
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGGCATA
miR156a-5p F:ACACTCCAGCTGGGTGACAGAAGAGAG
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTGCTCA
miR156j F:ACACTCCAGCTGGGTGACAGAAGAGAG
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTGCTCT
miR157d F:ACACTCCAGCTGGGTGACAGAAGATAG
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTGCTCT
miR157a-5p F:ACACTCCAGCTGGGTTGACAGAAGATAG
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTGCTCT
miR319c F:ACACTCCAGCTGGGTTGGACTGAAGGGA
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAGGAGC
miR319a F:ACACTCCAGCTGGGTTGGACTGAAGGGA
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGGGAGC
novel_126 F:ACACTCCAGCTGGGCATCGAAATCACCAG
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTCACAT
pc-3p-222 F:ACACTCCAGCTGGGTTTCCAAGACCACCC
  R:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCGGCAT
All R:TGGTGTCGTGGAGTCG