Skip to main content

Table 3 Primer sequences for qRT-PCR

From: Characterization and functional analysis of SIAH1 during skin and hair follicle development in the angora rabbit (Oryctolagus cuniculus)

NameSequences of primers (5′-3′)
GAPDHF: CACCAGGGCTGCTTTTAACTCT
R: CTTCCCGTTCTCAGCCTTGACC
SIAH1F: ACGACCGCGTCCAACAATGA
R: AGCTTTGGGCGACAGTTGCT
WNT2F: AGCCATCCAGGTCGTCATGAACCAG
R: TGCACACACGACCTGCTGTACCC
LEF1F: CATCTCGGGTGGATTCAGG
R: ATGAGGGATGCCAGTTGTG
FGF2F: GTGTGTGCAAACCGTTACCTT
R: TCGTTTCAGTGCCACATACCAG
SFRP2F: CCAGCCCGACTTCTCCTACAAGC
R: TCCAGCACCTCTTTCATGGTCT
DKK1F: CACAGAGGACGAGGAGTGTG
R: CTTCCTGCAAGCCAGACAGA
  1. F forward primer, R reverse primer