Skip to main content

Table 1 Characterization of 17 microsatellites of Apodemus agrarius chejuensis

From: Development of 17 polymorphic microsatellite loci from Jeju striped field mouse, Apodemus agrarius chejuensis (Rodentia: Muridae), by 454 pyrosequencing

Locus Repeat motif Repeat number range Primer sequence (5′-3′) Dye Size range (bp)
AC2 L TGTA 5–10 F: TTTCCCAGTCACGACGTTGGAACCTCAAAGAAGTGGGCTT 6FAM 213–233
R: GTTTCTTGGGATCATCAGCAGATAGCAG
ACH7 AACC 5–9 F: GCCCTGTACTTACCAACTCCC 6FAM 139–155
R: GGTAGGTCAATGAGTTGGGTTC
ACW7 CA 17–27 F: TTTCCCAGTCACGACGTTGCAAGCTTGGGATCGCAGT 6FAM 211–231
R: GTTTCTTGGCCCTTCCTGCATACTTTG
AC9S CA 18–25 F: TAAAACGACGGCCAGTGCTTTGTCCTTGCAAACTACCC 6FAM 260–274
R: GTTTCTTACCAAGATTGTAAGATGGCTGAA
ACAQ TG 15–31 F: TTTCCCAGTCACGACGTTGGCTTGGGATCATGTCCACTT 6FAM 162–194
R: GTTTCTTGACTGTTTAACTTGACTCTAGATTGTG
ACWV CCA 6–11 F: TTTCCCAGTCACGACGTTGGCTTGGGATCAGTTGCTAGG 6FAM 316–331
R: GTTTCTTTGTGAACACTGATGTTTATGTTCC
ACAV AG 5–9 F: TTTCCCAGTCACGACGTTGGGATCAAAGCCAGTCCTGAG 6FAM 192–200
R: GTTTCTTTTCTATCTTTAGGTACTCTGTTTCCC
ACU8 AACC 6–18 F: TTGGGATCAATCAGTCAGTCAG HEX 291–339
R: TGCATGAATTACTAAACAGAGTATCAA
AC9 M CA 4–5 F: GGAAACAGCTATGACCACCACGTTACACACACCATGC VIC 165–167
R: GTTTCTTGTGGTACAGGTAAAGCGTGGG
AC124 TG 6–8 F: GGAAACAGCTATGACCATTCCCGTCTGAGTGAAGACATG VIC 278–282
R: GTTTCTTGCACACTCTGCTTTTTCTTGGG
ACEC ATGA 5–10 F: GGAAACAGCTATGACCATGAGTGCAATGGCAGAAGTC VIC 148–168
R: GTTTCTTGGCCTCACGAGCATACAGA
ACQT AG 7–12 F: GGAAACAGCTATGACCATCTTTGTTTGACACCCACCA VIC 160–170
R: GTTTCTTGGTTCCTCACTCCCATTCAA
ACHZ TTTTG 7–16 F: GCGGATAACAATTTCACACAGGTCCCTTGAAGAGTGCTCACC PET 312–357
R: GTTTCTTCCTGAGGAGACCCATCCTTA
AC53 AAAC 7–15 F: GCGGATAACAATTTCACACAGGTTCAGAGGGTATACTGGGGAGG PET 313–345
R: GTTTCTTCAGTGTGGGCACTGTGAAAT
ACLI TG 5–6 F: TAAAACGACGGCCAGTGCGGCCACGCTAACAATCTCAT NED 231–233
R: GTTTCTTTGTTATGAATGCCCTGACCA
AC5S AC 20–49 F: TAAAACGACGGCCAGTGCTGGGATCAGTTAATTCAAGGC NED 153–211
R: GTTTCTTTCTGTAAGGCCAGAGGGCTA
ACPJ AC 10–36 F: TAAAACGACGGCCAGTGCTATCATCCCATAGCAGGCAGA NED 132–184
R: GTTTCTTAGCTTCTGTGATGGGATGGT
  1. F denote forward sequences and R denote revers sequences