Skip to main content

Table 2 primer sequences for the PCR amplification at the entire coding regions and exon/intron boundaries of the NPC1 gene

From: Identification of novel mutations among Iranian NPC1 patients: a bioinformatics approach to predict pathogenic mutations

Fragment Exon Forward(5’-3’) Reverse(5’-3’) Product size(bp) Tm (°C)
1 E1 AGCCGACGACGCCTTCTTCCTT ACAAGTGAGGAACCTCCGAGCTC 383 61.6
2 E2 GAAGTTTCTGTGATTGTACTTGAGT TCCACCTCCACCCTGCAATAACAT 310 61.7
3 E3 GTGTCTTAGTTCACTGAGGAATGTTG GAAAGCTGAGCATTACCAGTTCACA 253 64.3
4 E4 TGGACACAATAAATGCAGAAAGTAAT TGACAGGACAACTAAAAGGAACAAT 475 63.4
5 E5 AGCATGGTGCATATGGAGTTCGTG CAAGCACTGGTGAGCCACTGTGC 369 63
6 E6 GTATTTCAGTGGGCTTTTCTTTGAGT CATGGAGGTATTTGTTTCTTGTCCTA 475 62.5
7 E7 ACCTCACTGTGATGAAGTCCACTA CATGACAGACAGCATCATCTGAAC 178 60.7
8 E8 TGATTCCTGCCATGAGATAGCAACT CCCATCTAGCAGTAGTCAACATGTA 556 60.8
9 E9 ATGTGACGTGTTTCTGGGTTTGC GTCTTGTTGTTTGCTCACCTCTG 384 62.2
10 E10 AGGTGAGTGCTGAGCTGTATTA AGGAGATACTATTCTGGGATTCA 403 62.4
11 E11 AGATACAGTCCATAGCTCCAGTGAG TAAGTGCTTGCTGCAAGTGTCTAGC 288 61.1
12 E12 TCGTGAAAGTTAGGGAGAAGTTT GGCAACAGAAACGTTACATACAA 312 63.4
13 E13 TTTAGTAACAAGTGGGACAGACAAC AGGTCACACTCACGAATGCGGAG 339 64.3
14 E14 AGTCCCCCACCGAAGTTTAT AGCCAGCTCCTTCTTTCTCC 233 61.8
15 E15-16 GCTGTAAACAGAAGTGACGCAGA CTGGCTTCTTAGAAGGCATGTGAT 480 62.2
16 E17 CCTGTACTCCCTATTAGCCTGTCAT ACTTGCTTGAAACACCTACGTGCATG 322 63.2
17 E18 TGCTTAGTTACTATCAGAGTGTTCAC CCTCCTCCGCTGCTTCTGAAGTA 291 61
18 E19 CTGTGGAGCAGGTCAGTAACCCT GTATAAACTGAGGCACGATGCAAATG 245 62
19 E20 CTTCTAACAGTCCTCCCTGCA CTGTCTTAGCCCAGTCCTCTC 247 64.3
20 E21 TGCTTAGCCTCAAGTGCTCAGAT ACCCAGTGTAGGCCCTTTGCTG 337 63.7
21 E22 CATGAGAGGTCAAGTGAGTTG ATGCTCGCTCCCTCTATG 295 62.2
22 E23 CAGGGTGCCCTGGGTAATTAGCA GATCCAGACTCTTCAGTCACTGAG 292 61.6
23 E24 TTCAATTACAGGTTGGTAAAAGTGGTT CTTGAAAAGAATGCCTCAGGATAGA 297 63.1
24 E25 TTCCAAAGTGGGATTACAGGCGTG GACCGACCCTTAGACACAGTTCAG 221 64.3