Fig. 3From: A novel intron mutation in FBN-1 gene identified in a pregnant woman with Marfan syndromeSanger sequence diagram of the proband, the red arrow points to the mutation site. Polymerase chain reaction (PCR) amplication was performed using forward primer (caactcctgtgagctgttgc) and reverse primer (acgttgtccacagtgagtcc). The obtained sequence was compared with the FBN-1 reference gene (NM_000138.4) to identify mutationsBack to article page