Skip to main content

Table 1 Primers used for qRT-PCR verification

From: Comparative transcriptomic analysis of the tea plant (Camellia sinensis) reveals key genes involved in pistil deletion

Gene Forward 5′-3’ Reverse 5′-3’
CSA026751 CCCCCAGTGAGGCTCTCTTT TTGAAAGATGGCAAGCCACG
Novel05490 CGTGGATCGATAGGGCAAGC TCGGAAACCCTACCCAATCC
Novel11742 CCATGCTGACAGTGGCTTCT ATGTATAGACTTGCCTGCAATAGA
CSA010549 GCTTCTGGACTTGCTATGCG CTTGATGAGCTCTGGACGGG
Novel02945 AGAAGGTGGCAGAGCTGTTG TGTCAAGTTGGGTTGGGGAC
Novel00816 ACCAAGTGATCTTCCTGGTTT AGGCATGCTATATTGAGGGGC
CSA026801 GAAACGATCCAATGCCTGCC AGGCAATCCTATGTGCAGGG
CSA009488 GAGGCTCGAATTGGCAGGAT GGTCAAAGTTGGTAACGGCG
Novel05812 GGTCTAACAATGGCCCAAGCAC GCCTTCCCTAATGCTCTTTCCTCA
CSA014619 AAAGCTCGCGAACTCTCCAT GTTAACGCAGAGACCGAGGA
Novel05521 GCACTAGCAATCAACAAGTGACC GCTGCGCTCTCTGCGAAATA
CSA003190 TTCCAATCCATGCCCCACTC TAAACAGTCCAGGCCTTCGC
CSA016398 CTCACGGTGAACCCTCCTTC CTCGCATCGAATTGCAGAGC
Novel01833 AAGGATTTGTGTTGCCCTCG ACAAGCTTGGCTTGCATGAG
GAPDH TTGGCATCGTTGAGGGTCT CAGTGGGAACACGGAAAGC