Skip to main content

Table 2 Characteristics of the 29 EST microsatellite markers and population genetic diversity analysis for Shuangyang Sika deer

From: Development of novel EST microsatellite markers for genetic diversity analysis and correlation analysis of velvet antler growth characteristics in Sika deer

M Repeat Motif Primer Sequences (5′–3′) Tm Size (bp) Putative Function Na Ne He Ho PIC
M001 (TC)10 F: M13-TTCCCTTCTGGTTCTCAATCTC 60 246–252 Nop14-like family 4 3.1 0.6751 0.6496 0.6142
R: CTGACTCTCACGTCTAAGCTCTTCT
M002 (AC)10 F: M13-TATGAAAGGGCCTGGTTGTG 60 346–354 No significant match 4 1.1 0.3772 0.2791 0.2758
R: CCACCATGTAGCCAGAATGG
M005 (CT)10 F: M13-AATCGTATCACAGCACGGCT 60 282–288 No significant match 3 2 0.4983 0.518 0.4414
R: CCCTGGTTAAGAGTCCCAGAT
M009 (GA)7cag(GA)10 F: M13-CCACTAACTCTCCTGGCTGC 60 357–363 No significant match 4 2.4 0.5807 0.5333 0.5178
R: AAGATGGTTTACTCAGTAATCGATG
M027 (AT)8ttgaatccctctcctaaagcacagtatcttatataatactgtgattgcattga(TC)9 F: M13-TTCCTCACTTTCCTCATACATCTG 60 251–321 No significant match 12 2.1 0.5215 0.375 0.5029
R: ATCTTCCAGTCAGGTGTTCAGC
M037 (AC)9ccc(CA)8 F: M13-TCCCTCTAGCTGGAGCAATC 60 165–187 Bos taurus cytochrome P450 2C21-like 9 4.6 0.7845 0.6547 0.7507
R: CTCTTGACAGTTTGGCATGTATAGT
M073 (AT)10 F: M13-TTCAAATGAAGAAAGCTGAATG 60 109–113 Capra hircus family with sequence similarity 210 8 2.9 0.6546 0.5839 0.6031
R: GTAAAAGTCACTTTTAAAGGGTCA
M079 (CT)10 F: M13-CCTTAAAAGCATCATTTGAGCA 60 157–169 Gorilla gorilla gorilla transcription factor AP-2 alpha 5 2.8 0.649 0.6423 0.6083
R: GCTATAACTGCTTCCAAAACGG
M082 (AT)10 F: M13-CCATGTTTCTATTGGGTTGTCG 60 374–408 No significant match 14 3 0.6708 0.5547 0.6462
R: AACTGGATCTACACTTCACACGGT
M084 (GT)10 F: M13-AGGTCTTCCCCAGTGATGATG 60 422–424 No significant match 2 1.4 0.3087 0.292 0.2602
R: GAGTCAATATCTGGAGCTCTGCC
M089 (GA)10 F: M13-TTCCCTTCTGGTTCTCAATCTC 60 223–229 Pantholops hodgsonii thyroglobulin gene 4 3 0.6705 0.6475 0.6093
R: CTCCTGTGTTGCTCACTCTCATC
M092 (AC)10 F: M13-CCACCATCGGCGAAGAGTC 60 219–235 No significant match 5 2.7 0.6253 0.6331 0.5638
R: TGCTGAGCCGACTTCCTGC
M093 (TG)10 F: M13-TGTTGCTTGGGCTGTGGC 60 149–161 No significant match 6 2.1 0.532 0.4892 0.4623
R: GTGGGCCTTAATCCAGCAAG
M099 (AT)10 F: M13-ACAAATGGTGAAAACTCACTCC 60 202–208 Bos taurus probable E3 ubiquitin-protein ligase MID2-like 3 2.7 0.6281 0 0.5475
R: GGTTCCTTAGTATCCTTGGCAC
M102 (AT)10 F: M13-GGCTGCCTCGCTCTGTTCT 60 249–259 No significant match 6 3.3 0.7033 0.6763 0.6518
R: GCGATGGATGAACATTCAAGAA
M110 (GT)10 F: M13-GTTGGCTCTTGGTCCCTGAAT 60 155–177 Homo sapiens chromosome 5 clone CTD-2410 N18 9 3.4 0.7127 0.6449 0.665
R: ATCCTCCTCCAGATTCTCCACTT
M113 (GA)10 F: M13-AGGTTCCATCCTTGCCCTG 60 313–329 No significant match 6 2.9 0.6549 0.6544 0.605
R: AACTTAGCCCAGTGAAATGCG
M114 (AT)10 F: M13-GCTGGGTGACAAAGTGCTATG 60 166–176 Capra hircus family with sequence similarity 210 5 2.8 0.6477 0.6187 0.5962
R: TGAAGAAAGCTGAATGAAAGTTG
M117 (AC)10 F: M13-CACTGCATGCCTGCTTCCT 60 193–207 Pantholops hodgsonii snail family zinc finger 2 4 2.1
R: TTTACTTGTCACTCCGCCTCTG
M121 (CT)10 F: M13-GATCTCCCAGCCTGTCCTATG 60 251–255 No significant match 3 1.5 0.3413 0.3165 0.2912
R: ACACTTCCCTGAGCTGACCTTAT
M131 (AG)10 F: M13-CGAGTTCTGCTCATTGATGTG 60 164–172 Ovis aries Rho GTPase activating protein 19 3 2.3 0.5758 0.5827 0.4829
R: TCCTGTGACTCAACTGATACCTC
M132 (CT)10 F: M13-GAGTTCTGCTCATTGATGTGCT 60 149–157 Ovis aries Rho GTPase activating protein 19 3 2.3 0.5758 0.5827 0.4829
R: GATACCTCTAACCTCACTCAGCG
M136 (CA)10 F: M13-GACTCTTGGTCACAGCAGTCAC 60 207–221 Bos taurus SET domain containing 1B 5 2.3
R: ACTTCTGTACATAGGCTGCCAT
M139 (AG)10 F: M13-GCAGGAGTGAAAGGCAGATG 60 177–187 Bos taurus synapse differentiation inducing 1-like 6 2.5 0.6036 0.6475 0.5435
R: GGATTCTGCACTCAGTGGCT
M148 (CT)10 F: M13-TGATGCGTTCCTCTGTCAGC 60 383–385 Capra hircus transmembrane protein 164 4 2.1 0.5198 0 0.4682
R: AATGGTCTTCCACTAGCCGC
M157 (TC)10 F: M13-TTCTGACTGAGGAAGCGTCC 60 184–202 Homo sapiens chromosome 17, clone RP11-960B9 6 4.2 0.7644 0.7698 0.7265
R: GGTCCCATGACTTAGCCTTAC
M159 (CA)10 F: M13-TTCCAAACGCCAGAGGTAAC 60 207–215 Bos mutus ankyrin repeat domain 13A 5 3 0.6692 0.6763 0.6059
R: GCTAGTTGAAGGATATGCAGGC
M174 (AG)10 F: M13-CTTGTTGGAGGATGGATGGTT 60 120–132 Bos taurus protein inhibitor of activated STAT 4 2.3 0.5636 0.5683 0.4974
R: TCCAAGGACAAGTGTTAGAAAGG
M176 (AG)10 F: M13-GACACCACTTCTTGCCTCAAT 60 279–297 Bos taurus filamin B, beta 10 3.8 0.7391 0.252 0.6947
R: ATTAAGCCACTTGTCTCTACAGG
Average   5.6± 2.8 2.6± 0.8 0.6018 ± 0.1190 0.5127 ± 0.2010 0.5450 ± 0.1262