Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Suppression of miR-330-3p alleviates DSS-induced ulcerative colitis and apoptosis by upregulating the endoplasmic reticulum stress components XBP1

GenePrimer sequences
U6Forward: CGCTTCGGCAGCACATATAC
Reverse: TTCACGAATTTGCGTGTCAT
miR-330-3pForward: CAACTGCCTCTCTGGGCCTG
Reverse: CTGCAGAGAGGCAGCGCTG
XBP1Forward: ACATCTTCCCATGGACTCTG
Reverse: TAGGTCCTTCTGGGTAGACC
GAPDHForward: CCACATCGCTCAGACACCAT
Reverse: CCAGGCGCCCAATACG