Skip to main content

Table 4 SIAH1 overexpression and interference related primer sequences

From: Characterization and functional analysis of SIAH1 during skin and hair follicle development in the angora rabbit (Oryctolagus cuniculus)

NameSequences of primers (5′-3′)
SIAH1 CDSF: CCCAAGCTTATGATAGAAAGAAACTTGACTCCTA
R: CCGGAATTCTCAACACATGGAAATCGTTACATTG
siRNA-1F:GCACGACCGCGUCCAACAATT
R:UUGUUGGACGCGGUCGUGCTT
siRNA-2F:CCUCGUCUGGAUGUGAAAUTT
R:AUUUCACAUCCAGACGAGGTT
siRNA-3F:CCAGCAGUUCUUUGCAAUUTT
R:AAUUGCAAAGAACUGCUGGTT
siRNA-NCF:UUCUCCGAACGUGUCACGUTT
R:ACGUGACACGUUCGGAGAATT
  1. Bases in italics and underlined represent the enzyme cutting site. F forward primer, R reverse primer