Skip to main content

Table 1 Comparison results between STRsearch and CE for 9947A in the Ion S5 dataset

From: STRsearch: a new pipeline for targeted profiling of short tandem repeats in massively parallel sequencing data

MarkerSTR sequence sturucture1Alleles (a1, a2)Supporting reads (a1, a2)Alleles correction2 (a1, a2)Allele sequences (a1, a2)CE
D1S1677[TTCC]n13, 14592, 498[TTCC]13, [TTCC]1413, 14
D1S1656CCTA [TCTA]n18.3, 19.11182, 37818.3, 18.3CCTA [TCTA]13 TCATCTATCTATCTATCTA, CCTA [TCTA]13 TCATCTATCTATCTATCTACA18.3, 18.3
TPOX[AATG]n8, 72554, 958, 8[AATG]8, [AATG]78, 8
D2S441[TCTA]n10, 141007, 874[TCTA]8 TCTGTCTA, [TCTA]11 TTTATCTATCTA10, 14
D2S1776[AGAT]n10, 92825, 17210, 10[AGAT]10, [AGAT]910, 10
D2S1338[GGAA]n GGAC [GGAA]n [GGCA]n19, 23718, 715[GGAA]12 [GGCA]7, [GGAA]2 GGAC [GGAA]13 [GGCA]719, 23
D3S1358[TCTA]n [TCTG]n [TCTA]n15, 142052, 1916[TCTA]1 [TCTG]2 [TCTA]12, [TCTA]1 [TCTG]2 [TCTA]1114, 15
D3S4529[GATA]n AATA [GATA]n12, 111886, 6512, 12[GATA]4 AATA [GATA]7, [GATA]4 AATA [GATA]613, 13
D4S2408[ATCT]n10, 998, 56[ATCT]10, [ATCT]99, 10
FGA[GGAA]n GGAG [AAAG]n AGAA AAAA [GAAA]n7.5, 8.5693, 277.5, 7.5[GGAA]2 GGAG [AAAG]4 AGAA, [GGAA]2 GGAG [AAAG]5 AGAA23, 24
D5S2800[GGTA]n [GACA]n [GATA]n [GATT]n14, 231130, 876[GGTA]3 [GACA]6 [GATA]2 [GATT]3, [GGTA]9 [GACA]6 [GATA]3 [GATT]514, 23
D5S818[ATCT]n11, 112373, 29511, 11[ATCT]11, [ATCT]11 T11, 11
CSF1PO[ATCT]n10, 121348, 1178[ATCT]10, [ATCT]1210, 12
D6S1043[ATCT]n12, 181693, 1263[ATCT]12, ATCTATCTATCTATCTATCTATGT [ATCT]1212, 18
D6S474[AGAT]n [GATA]n14, 181898, 1304[AGAT]5 [GATA]9, [AGAT]5 [GATA]1313, 17
D7S820[TATC]n10, 111133, 823[TATC]10, [TATC]1110, 11
D8S1179[TCTA]n [TCTG] n [TCTA]n13, 131382, 998[TCTA]1 [TCTG]1 [TCTA]11, [TCTA]1313, 13
D10S1248[GGAA]n13, 15815, 811[GGAA]13, [GGAA]1513, 15
TH01[AATG]n ATG [AATG]n8, 9.31728, 1527[AATG]8, [AATG]6 ATG [AATG]38, 9.3
vWA[TAGA]n [CAGA] n TAGA17, 181330, 952[TAGA]12 [CAGA]4 TAGA, [TAGA]13 [CAGA]4 TAGA17, 18
D12S391[AGAT]n GAT [AGAT] n [AGAC]n AGAT18, 201171, 846[AGAT]11 [AGAC]6 AGAT, [AGAT]12 [AGAC]7 AGAT18, 20
D12ATA63[TTG]n [TTA]n13, 121697, 21413, 13[TTG]3 [TTA]10, [TTG]3 [TTA]913, 13
D13S317[TATC]n11, 102216, 17711, 11[TATC]11, [TATC]1011, 11
D14S1434[CTGT]n [CTAT]n11, 131418, 1094[CTGT]3 [CTAT]8, [CTGT]3 [CTAT]1011, 13
Penta E[TCTTT]n12, 13443, 425[TCTTT]12, [TCTTT]1312, 13
D16S539[GATA]n11, 122293, 1661[GATA]11, [GATA]1211, 12
D18S51[AGAA]n5, 32030, 1595, 5[AGAA]5, [AGAA]315, 19
D19S433[CCTT]n ccta [CCTT] n cttt [CCTT]n8, 7859, 485[CCTT]8, [CCTT]714, 15
D21S11[TCTA]n [TCTG]n [TCTA]n ta [TCTA]n tca [TCTA]n tccata [TCTA]n TA [TCTA]n30, 291450, 16630, 30[TCTA]6 [TCTG]5 [TCTA]3 ta [TCTA]3 tca [TCTA]2 tccata [TCTA]11, [TCTA]6 [TCTG]5 [TCTA]3 ta [TCTA]3 tca [TCTA]2 tccata [TCTA]1030, 30
Penta D[AAAGA]n4, 3206, 224, 4[AAAGA]4, [AAAGA]312, 12
D22S1045[ATT]n ACT [ATT]n11, 141033, 616[ATT]8 ACT [ATT]2, [ATT]11 ACT [ATT]211, 14
  1. 1Reference sequence repeat region sequence structure summary based on the most up-to-date forensic STR sequence guide
  2. 2Alleles correction according to the stutter ratio, which is 0.5 in this study. ‘-’, not applicable