Skip to main content

Table 8 Primers for real-time PCR of miRNAs

From: Identification and profiling of microRNAs responsive to cadmium toxicity in hepatopancreas of the freshwater crab Sinopotamon henanense

Gene Primer name Primer sequence (5′ to 3′)
Rpl38 Forward GTTAGACGGTGACTGCTGCTC
Rpl38 Reverse TCTTCACCGACTTTGCGTCC
miR-124-3p Forward TAAGGCACGCGGTGAATGCCA
miR-145 Forward GTCCAGTTTTCCCAGGAATCC
miR-216 Forward TAATCTCTGCAGGCAACTGTGA
miR-2419 Forward ATCGAATCGACACTCGTCTAA
miR-3878 Forward GTGGACGGAGAACTGATTTAA
miR-6907-3p Forward GCGTGCTTATCTTTTGTGTA
novel-m0106 Forward CATGCAGGTTGTTAAGCTGTCT
novel-m0148 Forward CTTTATCAATACGGATCAAAACTAA