Skip to main content

Advertisement

Table 1 Forward primers of miRNAs and primers of U6

From: Identification of serum microRNAs as diagnostic biomarkers for schizophrenia

Name Previous IDs Accession number Mature sequence Sequence (from 5′to 3′)
hsa-miR-30e-5p hsa-miR-30e MIMAT0000692 UGUAAACAUCCUUGACUGGAAG TGTAAACATCCTTGACTGGA
hsa-miR-130b-3p hsa-miR-130b MIMAT0000691 CAGUGCAAUGAUGAAAGGGCAU CAGTGCAATGATGAAAGGGCAT
hsa-miR-193a-3p hsa-miR-193a-3p MIMAT0000459 AACUGGCCUACAAAGUCCCAGU AACTGGCCTACAAAGTCCCAGT
hsa-miR-181b-5p hsa-miR-181b MIMAT0000257 AACAUUCAUUGCUGUCGGUGGGU AACATTCATTGCTGTCGGTGGGTT
hsa-miR-34a-5p hsa-miR-34a MIMAT0000255 UGGCAGUGUCUUAGCUGGUUGU TGGCAGTGTCTTAGCTGGTTGTT
hsa-miR-346 hsa-miR-346 MIMAT0000773 UGUCUGCCCGCAUGCCUGCCUCU TGCCCGCATGCCTGCCTCT
hsa-miR-7-5p hsa-miR-7 MIMAT0000252 UGGAAGACUAGUGAUUUUGUUGUU TGGAAGACTAGTGATTTTGTT
hsa-miR-449a hsa-miR-449 MIMAT0001541 UGGCAGUGUAUUGUUAGCUGGU TGGCAGTGTATTGTTAGCTGGT
hsa-miR-564 hsa-miR-564 MIMAT0003228 AGGCACGGUGUCAGCAGGC AGGCACGGTGTCAGCAGGC
hsa-miR-432-5p hsa-miR-432 MIMAT0002814 UCUUGGAGUAGGUCAUUGGGUGG TCTTGGAGTAGGTCATTGGGTGG
hsa-miR-548d-3p hsa-miR-548d MIMAT0003323 CAAAAACCACAGUUUCUUUUGC GCCAAAAACCACAGTTTCTTTTGC
hsa-miR-572 hsa-miR-572 MIMAT0003237 GUCCGCUCGGCGGUGGCCCA CGCTCGGCGGTGGCCCA
hsa-miR-652-5p hsa-miR-652 MIMAT0022709 CAACCCUAGGAGAGGGUGCCAUUCA CAACCCTAGGAGAGGGTGCCATTCA
hsa-miR-30a-5p hsa-miR-30a-5p MIMAT0000087 UGUAAACAUCCUCGACUGGAAG CACTCTCATGTAAACATCCTCGAC
U6 snRNA (Forward)   NR_004394   CTCGCTTCGGCAGCACA
U6 snRNA (Reverse)    AACGCTTCACGAATTTGCGT