Skip to main content

Table 2 Polymorphic markers associated with BPH resistance genes

From: Mapping and characterization of a quantitative trait locus resistance to the brown planthopper in the rice variety IR64

Marker Trait Forward primer (5'–3') Reverse primer (5'–3') Product size (bp) Type
YM35 Tolerance GCATGCTGTATTACAATTACGA GACAACGTACCACAGATTCC 160 InDel
RM302 Tolerance TGCAGGTAGAAACTTGAAGC AGTGGATGTTAGGTGTAACAGG 251 SSR
RM28366 Antibiosis AGGATACTTCGAAAGACTGAGC GTTTGTCACGAGAGCTTCTACC 454 SSR
RM463 Antibiosis GAGGATTAATTAGCGTGTGACC GTCGTGACATCTACTCAAATGG 388 SSR