Skip to main content

Table 1 Primer Sequences for q-PCR

From: Transcriptome profiling of the fertile parent and sterile hybrid in tea plant flower buds

Gene name Primer Sequence (5′ to 3′)
AP2 F:TACAGAGGAGTAACAAGGCATCA
R:CGTCAAAGTTCGTCACAGCA
JAR1 F:GCTTCCACAACTCAACTCCAGA
R:CAACAAGGCTCGTGAAATCG
ARF F:TGAAACAGAGGAGTCAGGCAA
R:CCAGTCTCATCCCACTCTACCT
IAA7 F:TCCAATGAGAAGAAAGACCCTG
R:CACCTTCACAAACGCCACA
AUX1 F:ACTGAGGCTGAGGTTGGTGA
R:TTAGATTTGATGGGCGTGGT
ATL3 F:CACACTAACCCTACCATCAGCA
R:CAGTGTCTCTGAAACCAGTCCTT
GAPDH F:GATAGTGTTCACGGTCAATGGA
R:GCAGCAGCCTTATCCTTATCAG