Skip to main content

Table 1 Primer sequences used for qPCR

From: Global transcriptome analysis of H5N1 influenza virus-infected human cells

Gene Name Forward Primer (5′- 3′) Reverse Primer (5′- 3′)
RIN1 GCACCTGGCGAGAGAAAAG TAGATTTCCGCACGAGGAACG
TNF-α GGAGAAGGGTGACCGACTCA TGCCCAGACTCGGCAAAG
IFIT2 AAGCACCTCAAAGGGCAAAAC TCGGCCCATGTGATAGTAGAC
ELOVL3 CTGTTCCAGCCCTATAACTTCG GAATGAGGTTGCCCAATACTCC
ISG15 CGCAGATCACCCAGAAGATCG TTCGTCGCATTTGTCCACCA
IFIT1 TTGATGACGATGAAATGCCTGA CAGGTCACCAGACTCCTCAC
AKR1C3 GTCATCCGTATTTCAACCGGAG CCACCCATCGTTTGTCTCGTT
TXN GTGAAGCAGATCGAGAGCAAG CGTGGCTGAGAAGTCAACTACTA