Skip to main content

Table 1 All molecular marker primers sequence of SCoT and IRAP used in this research

From: Genetic diversity of Bletilla striata assessed by SCoT and IRAP markers

SCoT primer IRAP primer
Code Sequence(5’to3’) Code Sequence(5’to3’) Code Sequence(5’to3’)
SC3 CAACAATGGCTACCACCG SC19 ACCATGGCTACCACCGGC LIRE3-F CCTCAAAGCTCTCTTCTCCTTC
SC4 CAACAATGGCTACCACCT SC20 ACCATGGCTACCACCGCG LIRE3-R CCTAGAGTTGTACATTTACATT
SC5 CAACAATGGCTACCACGA SC21 ACGACATGGCGACCCACA LIRE-Tar-F CATYATCRGTGGAGCTCT
SC6 CAACAATGGCTACCACGC SC22 AACCATGGCTACCACCAC LIRE-Tar-R AATCATYYYGAGAGCTCTCC
SC7 CAACAATGGCTACCACGG SC23 CACCATGGCTACCACCAG LIRE-del-F1 TTGAAACCACYAGCTCAAGGTA
SC9 CAACAATGGCTACCAGCA SC24 CACCATGGCTACCACCAT LIRE-del-F2 TATAAAATGTCRGGTCGTGA
SC10 CAACAATGGCTACCAGCC SC25 ACCATGGCTACCACCGGG LIRE-del-R TCATGRAGRTGATARAGWYTAACC
SC11 AAGCAATGGCTACCACCA SC26 ACCATGGCTACCACCGTC DO-F TCCACAAGGCTATCTATG
SC12 ACGACATGGCGACCAACG SC27 ACCATGGCTACCACCGTG DO-R GAGGGATTGGACTTACTG
SC13 ACGACATGGCGACCATCG SC28 CCATGGCTACCACCGCCA   
SC14 ACGACATGGCGACCACGC SC30 CCATGGCTACCACCGGCG   
SC15 ACGACATGGCGACCGCGA SC31 CCATGGCTACCACCGCCT   
SC16 ACCATGGCTACCACCGAC SC32 CCATGGCTACCACCGCAC   
SC17 ACCATGGCTACCACCGAG SC33 CCATGGCTACCACCGCAG   
SC18 ACCATGGCTACCACCGCC SC34 ACCATGGCTACCACCGCA