Skip to main content

Table 2 Primers for Sanger sequencing. No.1–10: Exon primers; No.11–20: Quantitative real-time primers; No.21–26: Breakpoint primers

From: Long-read sequencing identified a causal structural variant in an exome-negative case and enabled preimplantation genetic diagnosis

No. Primer Position Sequence (5′-3′)
1 G6PC-1F Exon1 CACCACCAAGCCTGGAATAAC
2 G6PC-1R CAGACATTGCGAGAGCGAATG
3 G6PC-2F Exon2 GCATTCATTCAGTAACCC
4 G6PC-2R AGACAGAAGCTGAGTGGA
5 G6PC-3F Exon3 CACCTTTACTCCATTCTCTTTC
6 G6PC-3R GTGCCACAACTCTTAATCAGCG
7 G6PC-4F Exon4 CACTGAGAGCACCTAAGTTTGC
8 G6PC-4R CTGATTACACACAGGATGTGG
9 G6PC-5F Exon5 CATGTCACCCACTCCTCCAAAC
10 G6PC-5R GTCACTTGCTCCAAATACCAGTG
11 G6PC-1ForF 5′-Flanking introns TTTCACAGTCCTCCGTGACC
12 G6PC-1ForR AGGGCTTCTATATCTTGAGCTTTC
13 G6PC-1QF Exon1 TCCAGTCAACACATTACCTCCA
14 G6PC-1QR TAAAGACGAGGTTGAGCCAGTC
15 G6PC-2inF Intron2–3 AAGTTGGGACAAGGGAATCAGA
16 G6PC-2inR CATTCTTAATTCCTCTACCCTGAGA
17 G6PC-4QF Exon4 GCTGAAGGATCTGCACCTGT
18 G6PC-4QR AGGGAGTCAGATCAGCCCAT
19 G6PC-5QF Exon5 CAGCTTCGCCATCGGATTTT
20 G6PC-5QR ACAATAGAGCTGAGGCGGAA
21 G6PC-D1F   GTGGGGAAAATGCCTGAGGA
22 G6PC-D2F   TTTTCACCCTTGGGAGCCTG
23 G6PC-D3F   GGTCACCCTGTCCCACTAGA
24 G6PC-D4F   CTCACCTGTTTTCCCACGGA
25 G6PC-D5F   GGGAGGAGACTCCAGGTCAT
26 G6PC-comR Intron2–3 CTTTCCAGTCTGTGCCTCCAT