Skip to main content

Table 1 Primer sequence used in this study

From: Characterization of TaDREB1 in wheat genotypes with different seed germination under osmotic stress

Primer Primer sequence(5′-3′) Fragment size (bp) Anneal temp.(°C)
DREB1-A1F CGGAACCACTCCCTCCATCTC 1107 62
DREB1-A1R CGGTTGCCCCATTAGACGTCA   
DREB1-A2F CTGGCACCTCCATTGCTGAC 599 63
DREB1-A2R AGTACATGAACTCAACGCACAGGACAAC   
DREB1-BF CCCAACCCAAGTGATAATAATCT 716 58
DREB1-BR TTGTGCTCCTCATGGGTACTT   
DREB1-D1F TCGTCCCTCTTCTCGCTCCAT 1190 63
DREB1-D1R GCGGTTGCCCCATTAGACATCG   
DREB1-D2F CTGGCACCTCCATTGCCGAT 596 64
DREB1-D2R AGTACATGAACTCAACGCACAGGACAAC   
DREB U TCGTCCCTCTTCTCGCTCCATGG 493 66
DREB D GGGCATGGCG CCGCATGG   
DREB1-AF ATGAACAGGAAGAAGAAAGTGCGC 593 62
DREB1-AR TTCTCAAATCATTGCTCACT TCTTTC   
DREB1-BF ATGACCAGGAAGAAGAAAGTGCGC 585 60
DREB1-BR TCATTGCTCACTTCTTTTTTCACCTTAT   
DREB1-DF ATGAACAGGAAGAAGAAAGTGCGC 455 62
DREB1-DR TCCTTCCCATCAGAAGGATGTGAC   
β-actin F GTTTCCTGGAATTGCTGATCGCAT 410 65
β-actin R CATTATTTCATACAGCAGGCAAGC