Skip to main content

Table 2 Information of 22 pairs of specific indel primers used in this study

From: The genetic locus underlying red foliage and fruit skin traits is mapped to the same location in the two pear bud mutants ‘Red Zaosu’ and ‘Max Red Bartlett’

Primer Scaffold Position Forward primer Reverse primer
In1270–1 NW_008988270.1 (Scaffold 244.0) 65,865 AGAAAGGAGGAGGAGGAAG AAATCCAAGCCCTATAAACC
In1270–2 NW_008988270.1 (Scaffold 244.0) 128,003 AATAGGCCAGCATACCATAA TAATGAACAATACCCATCCG
In1270–3 NW_008988270.1 (Scaffold 244.0) 160,055 ATTGCTACAAAGCTGCTCTC TATTTTGCCCTTACAGTTCG
In1270–4 NW_008988270.1 (Scaffold 244.0) 208,561 TACCTACCGGTGTCTGATTC ATTGTTTTGGTTTTGTTGCT
In1270–5 NW_008988270.1 (Scaffold 244.0) 257,130 TTTTAAGGGGCAATTTATGA AACCTCCAAAAACAAACAAA
In1270–6 NW_008988270.1 (Scaffold 244.0) 309,525 AGAATTCAGAAATGGGGTTT TAATCGACATTGACACGAAA
In1270–7 NW_008988270.1 (Scaffold 244.0) 352,640 CGTGAGAGCTTACTCAGACC CTAATGTTATTGAAGCGGGT
In1270–8 NW_008988270.1 (Scaffold 244.0) 403,691 ATAGAACGGGTCTTTTTGGT TTTCATAATTTGTGGGACATT
In1270–9 NW_008988270.1 (Scaffold 244.0) 457,893 TCTAAGGGCTGGACAGAATA TTAAGTAAGGAGTCGGCAAC
In1322–1 NW_008988322.1 (Scaffold 297.0) 125,085 TTGAGGTTTCTTTTTGGTTG TTGATATAAACCAGGGGATG
In1322–2 NW_008988322.1 (Scaffold 297.0) 150,815 TTACTGACAGCATCTGACCA CAACTGGATGATTTCCTCAT
In1322–3 NW_008988322.1 (Scaffold 297.0) 202,780 GCCTTTCTGTTTGCTAGAAG ATCTTCTACAACTTGCTGCC
In1322–4 NW_008988322.1 (Scaffold 297.0) 250,555 TCTAAAAATGAAGCAGACCC CTCTTTCGATTTTCTTGTGC
In1400–1 NW_008988400.1 (Scaffold370.0) 161,533 CAAGGACCAAAGTCACGTAT TCTTCGACTTTAGGAAAAGAGT
In1400–2 NW_008988400.1 (Scaffold370.0) 204,789 GTATTTATGGACAAGCAGGC TAACCACCCTGAGAATATGG
In1400–3 NW_008988400.1 (Scaffold370.0) 244,039 AAAATCGTTCCTTTCATGG GAGGTTAAGCCCACTCCTAT
In1400–4 NW_008988400.1 (Scaffold370.0) 305,894 GAAATGAAAGAACGAAGGTG TTTGACTTTTCTTCTGTGGG
In1400–5 NW_008988400.1 (Scaffold370.0) 344,900 AAGAAAAAGGGGCTTTTAGA AATCCATTCGGTACAGTCAG
In1579–1 NW_008988579.1 (Scaffold545.0) 23,081 CATGTTACAGGTCCAACCTT CCTATTGCAATCTGAAATCC
In1579–2 NW_008988579.1 (Scaffold545.0) 50,472 GCCCTAATTAAATGTCCTCA AGGTGAGATCACAAGTGGAC
In1579–3 NW_008988579.1 (Scaffold545.0) 100,223 TTTCGACTCTTGCTTACCTC ACGAAGTGCTTTTTACCAAA
In1579–4 NW_008988579.1 (Scaffold545.0) 152,991 GGAGTCTGGCTCATGTAATC ACTTGGGCTATAGGGACACT