Skip to main content

Table 1 The primers for selected DEGs and Tubulin

From: Identification of candidate genes involved in the sugar metabolism and accumulation during pear fruit post-harvest ripening of ‘Red Clapp’s Favorite’ (Pyrus communis L.) by transcriptome analysis

Gene Forward primer (5′-3′) Reverse primer (5′-3′)
PCP011895 CTTCAAGGATTGCCACAT TGTATCGTATTATTCAAGTAGAGG
PCP005049 ACATCACAATAGGTTCTG TCTCAACTTCACATTCTG
PCP013141 AACCACCTCTTCTGATGA ACCACAAGTAGTCTGTAGTA
PCP008001 GGTCATATTCCTCTTGTCATTAG TTGTTCTGGCACTGTCTT
PCP030959 TCGGTCATATTCCTCTTGTC TTGTTCTGGCACTGTCTT
PCP006674 GCTTGGTCTTGAATATGA CGGCAGAATCTTAATGTA
PCP005278 TAGCCAGAGCAATAAGGA GGAGTTCGTTCAAGTGTT
PCP012345 GTAGCAGTGGATTCATAGC GCATCAGTAGCATTGGTT
newGene_4807 CAAGAAGCAGCAAGAGAA CACTAGGAATCAAGGCATC
PCP005062 GCTTCTGTTGTTATCTCCTCTA TTCCACCACTGCTGATTG
Tubulin TGGGCTTTGCTCCTCTTAC CCTTCGTGCTCATCTTACC