Skip to main content

Table 2 Oligonucleotides used as PCR primers to amplify and sequence the gene encoding the Gα-subunit of the heterotrimeric G protein and to amplify gene fragments located in the genomic region surrounding this gene in a BAC pool screening

From: Mutations in the gene of the Gα subunit of the heterotrimeric G protein are the cause for the brachytic1 semi-dwarf phenotype in barley and applicable for practical breeding

Primer name Sequence (5′ → 3′) Template Length of amplification product [bp]
bw-Fr1-F1 TGTCAAGATGATGGCTTCAG Genomic DNA 703 (with bw-Fr1-R1)
bw_Fr1-Fseq AAAAAGACGATGATGAAGC Genomic DNA  
bw-Fr1-R1 GATCGACGAGAGCATGAGAC Genomic DNA  
bw-Fr2-F1 GGCGAGGTAGAAAGCAAAAG Genomic DNA 790 (with bw-Fr2-R1)
bw-Fr2-R1 TTTTGAGGTATCCATCCATCTC Genomic DNA  
bw-Fr3-F1 CGCACACAGTCAAAGGAAC Genomic DNA 896 (with bw-Fr3-R1)
bw-Fr3-R1 GACAGCATTGCACAAGGAG Genomic DNA  
bw-Fr4-F1 TGTCCCAGATCCTCAAACTG Genomic DNA 901 (with bw-Fr4-R1)
bw-Fr4-R1 TTGTCCCTTGTAAACTGTTGG Genomic DNA  
bw-Fr5-F1 TCCTCCTGCAAAATCTCTCC Genomic DNA 903 (with bw-Fr5-R1)
bw-Fr5-R1 TTAGACTCGGCATTTTGAGG Genomic DNA  
bw-Fr6-F1 ACCTGAATGGCTGGATCTTC Genomic DNA 857 (with bw-Fr6-R1)
bw-Fr6-R1 GCATAGTGGGGATTATTCAGG Genomic DNA  
bw-Fr7-F1 GGTCCAAACAGGTTCAGTTG Genomic DNA 824 (with bw-Fr7-R1)
bw-Fr7-R1 GATTCTGCACGAGACAAAGG Genomic DNA  
bw-Fr8-F1 GGAATCAGTCTTTCCAGATCC Genomic DNA 705 (with bw-Fr8-R2)
bw-Fr8-R2 CCAAAATACCCATACCAACC Genomic DNA  
bw-Fr9-F1 GAGCGAGCCAGAGATTTTG Genomic DNA 711 (with bw-Fr9-R1)
bw-Fr9-R1 TGTATATGACGGAGCAGCAAG Genomic DNA  
bw_Fr9-Rseq GCTTGTTGGTTGTAGCTCAG Genomic DNA  
IL130 CAACAATATGGGCATTACAT BAC 350 (with IL131)
IL131 CGAGGAGTTCTACAAATCAT BAC  
IL132 CTTGCCCACTTACCAGGTGG BAC 300 (with IL133)
IL133 ACGGGATCTCCTTATGGAGC BAC  
IL134 ATGATCGACTGCTACATCC BAC 318 (with IL135)
IL135 GGTTCTGTCGTTGTACCTAG BAC  
IL136 CACCAAGCAGCAGATGATC BAC 152 (with IL137)
IL137 CCAGTTTGTTGGATGTTTCC BAC  
IL138 GAGGGCTTCTATTGAAAGTG BAC 510 (with IL139)
IL139 GGTACTGACCAACTGTTACG BAC  
IL140 AAAAGGCTGACTCAAAGACC BAC 318 (with IL141)
IL141 CGACAAGCTCCATAAGGTAC BAC  
IL142 TCTGACCCAGAAACTTGATC BAC 651 (with IL143)
IL143 GAAAGGGAGAGAGAAATCG BAC  
IL144 GGTCTGACCTCTTATTTCCC BAC 512 (with IL145)
IL145 AAAGCGAGGCATTCACTAG BAC  
IL146 GCTCAAAGTGGGAATACGAG BAC 475 (with IL147)
IL147 CTTGTGCTGCCAACTAGATG BAC  
IL148 AAGAGCATCCAGTGACAAG BAC 633 (with IL149)
IL149 GGATCTCCGCTTAGGTATAG BAC  
IL150 CGCTTTCCCTATTTTGTCAG BAC 576 (with IL151)
IL151 ACTTCACGGAGATTGATGC BAC  
IL152 AGCCAGCAATCCTTGTTAGC BAC 510 (with IL153)
IL153 ACCTTGAGCCAGGGAAAAG BAC  
IL201 CTCTGGCTCGCTCATCAACC RNA 1229 (with IL202)
IL202 AGCGTCTCATGCTCTCGTCG RNA  
IL203 GTAAACGAGGCAGAGGCAGC RNA 461 (with IL204)
IL204 CAGTCGGGAACTTGCAGCAC RNA  
IL205 CGGAACTCAAGGGCTACACG RNA 600 (with IL206)
IL206 CGAACAGCTCCTTGGTCTCC RNA  
IL207 AAATCTCTGGCTCGCTCATC RNA 1389 (with IL208)
IL208 AGCACAAAGGAGTCACAAGG RNA  
IL209 ACTAGGAGGAAGCATGAGAC RNA 1305 (with IL210)
IL210 CAATACAGAGTTGCGACACC RNA