Skip to main content

Table 3 Allele-specific primers for rice

From: PCR-based assays for validation of single nucleotide polymorphism markers in rice and mungbean

Locus name Primer name Fragment length Common primer Allele-specific primer 1 Allele-specific primer 2
4:22435296 AS1 219 CGACAGGGAGAAATCCTGAA 5’-GACTTGGCAGGTAAAACAGGTTACG-3' 5’-CACTACAAAGGCTGTGGCAGGTAAAACAGGATAGA-3'
5:44806 AS2 189 GCCTTGCAGGCTCCTATTTT 5’-AGTCAAAGCTTCAGGCTCTAGCTGC-3’ 5’-CGACTAACTGTGACTAAGCTTCAGGCTCTAGCATA-3’
6:14504992 AS3 209 CCTTGCCCTGTTATTCCTGA 5’-CCAGTTTTCTCCTTGTGCCAGATTG-3’ 5’-GATGTCTACTCCAGTTTTCTCCTTGTGCCAGAGAA-3’
7:3650191 AS4 293 CAAGTTTGTAGGTGCTGACCA 5’-GATCCTAACTGAAGTGAAAACAGCA3’ 5’-TGCGTCATAGGATCCTAACTGAAGTGAAAACACAC-3’
9:6982338 AS5 162 TTCTTGGGGTTGGCTACAAG 5’-ACTGCTGTACTTGTATTTGCCGCAC-3’ 5’-CATTGTATTTTTACGTGTACTTGTATTTGCCGATT-3
  1. The allele-specific base, as well as the additionally introduced variant base near the 3’end are underlined. The primer extension sequences are printed in small letters. The fragment length excludes the extensions of the allele-specific primers