Skip to main content

Table 2 Outer and inner primer for tetra markers for mungbean. The outer primer were also used for producing PCR fragments for CEL-I genotyping. The fragment length refers to the fragments produced with the outer primers

From: PCR-based assays for validation of single nucleotide polymorphism markers in rice and mungbean

Locus name Primer name Frag. length Outer Fwd Inner Fdw Inner Rev Outer Rev
1:26,370,595 Tetra_6 208 CCGAAGATGTGTGATTCATG GACGATACTTGTCCAGATAT GAAGGGATTTTGTTAGGAGT AGCACTCAAGATGAAAGTGATC
2:23,741,639 Tetra_7 260 ACTATCTGACCGAAAGGAA TTGGTACCAAATTCTGCACT ATCTTACGGTGAAGGACATT ATCTGCTGACAGGAGAATTCA
3:11,561,441 Tetra_8 236 CCCCTAAAGCTGGAATATA TCTTCAAAGAGCTCCTTTTG GATTGTCACTTTGTCAAAG TGATCATCAAGCTACACTTC
3:10,830,938 Tetra_9 275 AGCGAGGACAAGGAAGAATT TCTGCGGTGTTCTTAGAGT TTCCTCCAAATGCTGCAGAC GGCAAATTATTAGGATCCTGC
5:9,090,455 Tetra_10 250 TCGCTTAACCAAGAATCGC CCAATGCGAATCAGATG AAAACGCACATCTGGTTCGTGT CGACATGGTGGCAATTTGAT
7:13,713,780 Tetra_11 253 TAGCTGGTCCGTGTACTTTA TTTCCATTGTGGGTCGTGGAGT GCAGCAACATGTGCAACAT GGAACTATGCTTTGGGACTT
10:3,159,416 Tetra_12 269 ATACTGGAGGGTTGTTTCTA TAAGCGTGCGCAGCCATAAACAAG GGGTTTTTTCGGAAATTCAAAG CGGTCTCAGAATCATAGTCTTG
12:9,262,432 Tetra_13 215 AACCCCTTTATATAGGGTCTG TCATCTTCTCCGGGCAGCTCCTTC GAGGTGAAGGCACGTGACCA TCATTCGAGGAAAGGAGAGA