Skip to main content

Table 1 Outer and inner primer for tetra markers for rice. The outer primers were also used for producing PCR fragments for CEL-I genotyping. The fragment length refers to the fragments produced with the outer primers

From: PCR-based assays for validation of single nucleotide polymorphism markers in rice and mungbean

Locus name Primer name Frag. length Outer Fwd Inner Fdw Inner Rev Outer Rev
4:22435296 Tetra_1 310 GGAACATGTCGCATTCACAGT GCAGGTAAAACAGGTTAGG AATTGATGCCTGACTGGCTGACT CGACAGGGAGAAATCCTGAA
5:44806 Tetra_2 302 ACACATCGATCCAGCTTACCA TAAGCTTCAGGCTCTAGCTTC GTGAGAAAGTAAAGGAC GCCTTGCAGGCTCCTATTTT
6:14504992 Tetra_3 288 CGCCAAGAAAATGTGCAGTA TTCTCCTTGTGCCAGATAG CACCACGGAGGTTTCTAAT CCTTGCCCTGTTATTCCTGA
7:3650191 Tetra_4 222 AGTGCCTGCATGATTGAACA CTGAAGTGAAAACAGAGC GTTTATTTCAAACGGGCG CAAGTTTGTAGGTGCTGACCA
9:6982338 Tetra_5 201 GCGGAATTACACTGTTTTTGG TGTACTTGTATTTGCCGCTC CCCTAAGATGTCTTAAAAATA TTCTTGGGGTTGGCTACAAG