Skip to main content

Table 1 The ISSR, SCoT, and EST-SSR primers used in this study and amplification results

From: Genetic variation, population structure and linkage disequilibrium in Switchgrass with ISSR, SCoT and EST-SSR markers

Primer Primer sequence (5′ → 3′) Annealing (°C) Total number of amplified bands (TNB) The number of polymorphic bands (NPB) Percentage of polymorphic bands (PPB) %)
ISSR-UBC812 (GA)8A 52.0 13 12 92.31
ISSR-UBC827 (AC)8G 53.0 10 10 100.00
ISSR-UBC828 (TG)8A 52.0 9 8 88.89
ISSR-UBC829 (TG)8C 52.0 12 10 83.33
ISSR-UBC830 (TG)8G 55.0 14 13 92.86
ISSR-UBC835 (AG)8YC 52.0 15 13 86.67
ISSR-UBC836 (AG)8YT 54.0 17 14 82.35
ISSR-UBC844 (CT)8RC 52.0 14 12 85.71
ISSR-UBC848 (CA)8RG 53.0 14 13 92.86
ISSR-UBC854 (TC)8RG 52.0 15 15 100.00
ISSR-UBC868 (GAA)6 55.0 13 12 92.31
ISSR-UBC876 (GATA)2(GACA)2 52.0 16 13 81.25
ISSR-UBC879 (CTTCA)3 53.0 17 14 82.35
ISSR-UBC887 DVD(TC)7 52.0 14 14 100.00
ISSR-UBC890 VHV(GT)7 52.0 13 11 84.62
ISSR-UBC891 HVH(TG)7 52.0 14 12 85.71
SCoT2 CAACAATGGCTACCACCC 55.0 17 14 82.35
SCoT3 CAACAATGGCTACCACCG 55.0 34 31 91.18
SCoT4 CAACAATGGCTACCACCT 55.0 21 19 90.48
SCoT5 CAACAATGGCTACCACGA 55.0 21 19 90.48
SCoT6 CAACAATGGCTACCACGC 55.0 22 20 91.91
SCoT7 CAACAATGGCTACCACGG 55.0 22 20 91.91
SCoT9 CAACAATGGCTACCAGCA 55.0 20 19 95.00
SCoT10 CAACAATGGCTACCAGCC 55.0 21 20 95.00
SCoT12 ACGACATGGCGACCAACG 55.0 25 24 96.00
SCoT13 ACGACATGGCGACCATCG 55.0 25 22 88.00
SCoT15 ACGACATGGCGACCGCGA 55.0 18 16 88.89
SCoT16 ACCATGGCTACCACCGAC 55.0 26 24 92.31
SCoT18 ACCATGGCTACCACCGCC 55.0 20 18 90.00
SCoT21 ACGACATGGCGACCCACA 55.0 21 19 90.48
SCoT28 CCATGGCTACCACCGCCA 55.0 25 22 88.00
SCoT31 CCATGGCTACCACCGCCT 55.0 22 19 86.36
SCoT34 ACCATGGCTACCACCGCA 55.0 21 19 90.48
SCoT35 CATGGCTACCACCGGCCC 55.0 21 19 90.48
SCoT37 CAATGGCTACCACTAGCC 55.0 23 20 86.96
SCoT48 ACAATGGCTACCACTGGC 55.0 20 18 90.00
EST-SSR-cnl35 f: AAGTGAGCACAACGACACGA 58.0 9 8 88.89
r:CGATCCAAAGAAGCAAAGATG
EST-SSR-cnl37 f:CTGCCTCGCGTGAAAGATA 59.0 10 9 90.00
r:CCTCCTCGATCTGGATGGT
EST-SSR-cnl42 f:GTTGGTCTGCTGCTCACTCG 59.0 9 8 88.89
r:CCGACGATGTTGAAGGAGAG
EST-SSR-cnl47 f: GACTCGCACGATTTCTCCTC 57.0 9 8 88.89
r:GCCAGACAACCAATTCAGGT
EST-SSR-cnl51 f:CTAGGGTTTCCCACCTCTCA 59.0 8 6 75.00
r:AATGTCCTTGGCGTTGCT
EST-SSR-cnl55 f:GCTGATAGCGAGGTGGGTAG 58.0 14 11 78.57
r:CTGCCGGTTGATCTTGTTCT
EST-SSR-cnl61 f:CACGAGTGCAGAGCTAGACG 60.0 5 4 80.00
r:ACAACAACCCGACTGCTACC
EST-SSR-cnl86 f:CAACAACGTCAACGCCTTC 59.0 11 8 72.73
r:GCGTCTTGAACCTCTTGTCC
EST-SSR-cnl100 f:CGTCGTCCTCTGCTGTGAG 58.0 5 4 80.00
r:AGGTCGTCCATCTGCTGCT
EST-SSR-cnl115 f:CGAGAAGAAGGTGGTGTCGT 59.0 7 6 85.71
r:AGGTCGTGGAAGGTCTTGG
EST-SSR-cnl119 f:ATCGTCTCCTCCTCCTCCA 57.0 6 6 100.00
r:ATGCCTCGGTGGACTGGTA
EST-SSR-cnl130 f:AAATGTTGAGCAACGGGAGCT 59.0 7 6 85.71
r:ACTTCATAGGGCGGAGGTCT
EST-SSR-cnl144 f:AGAAGGCGGCTCAGAAGAAG 58.0 10 10 100.00
r:GCTCCAACTCAGAATCAACAA
EST-SSR-cnl147 f:GGCTAGGGTTTCGACTCCTC 60.0 9 7 77.78
r:AGATGGCGAACTCGACCTG
EST-SSR-cnl158 f:CTCATCCCACCACCACCAC 59.0 9 9 100.00
r:CCCTGAAGAAGTCGAACACG
Total    793 708 89.28